CHI3L1 shRNA lentivirus

CHI3L1 shRNA lentivirus

Catalog Number:
PLP1516181CEL
Mfr. No.:
PLV-10106-50/200
Price:
$704
  • Size:
    Quantity:
    Add to Cart:
      • Overview
        • In humans, CHI3L1 encodes Chitinase-3-like protein 1 (CHI3L1) that a glycoprotein member of the glycosyl hydrolase 18 family. It is a secreted glycoprotein and catalyzes the hydrolysis of chitin glycopolymer found in insect exoskeletons and fungal cell walls. The protein lacks chitinase activity and is secreted by activated macrophages, chondrocytes, neutrophils and synovial cells. It may play a role in tissue remodeling and in the process of inflammation in respond to the changes in their environment.

          Please contact us at for specific academic pricing.

      • Properties
        • Other Properties
          Virus: CHI3L1 shRNA lentivirus
          Titer (approx): 1 x 10^8 CFU/ml
          Vector Information: Vector includes both 5' and 3' lentiviral LTR and all necessary elements for effective transduction; woodchuck hepatitis virus posttranscriptional regulatory element (WPRE)
          Promoter for Target Gene: U6
          Target Gene / Reporter(s): CHI3L1
          Species: Human
          Construct ID: shRNA TRCN0000051953
          Other Identifier: NM_001276.1-588s1c1
          Sequence: CCGGCAAGGAAATGAAGGCCGAATTCTCGAGAATTCGGCCTTCATTTCCTTGTTTTTG
          Knockdown Efficiency: N/A
          Selection Gene: Puromycin
          Biosafety Level: BSL-2
          Storage
          Store at -80°C
          Shipping
          Dry ice

          * For research use only. Not for diagnostic or therapeutic use.

    Note: If you don't receive our verification email, do the following:

    Copyright © Amerigo Scientific. All rights reserved.