Login / Register

0

CHI3L1 shRNA lentivirus

CHI3L1 shRNA lentivirus

Catalog Number:

PLP1516181CEL

Mfr. No.:

PLV-10106-50/200

Price:

$704

Size:

Quantity:

Add to Cart:

- Overview
  - In humans, CHI3L1 encodes Chitinase-3-like protein 1 (CHI3L1) that a glycoprotein member of the glycosyl hydrolase 18 family. It is a secreted glycoprotein and catalyzes the hydrolysis of chitin glycopolymer found in insect exoskeletons and fungal cell walls. The protein lacks chitinase activity and is secreted by activated macrophages, chondrocytes, neutrophils and synovial cells. It may play a role in tissue remodeling and in the process of inflammation in respond to the changes in their environment.
    
    Please contact us at for specific academic pricing.
- Properties
  - Other Properties
    
    Virus: CHI3L1 shRNA lentivirus
    Titer (approx): 1 x 10^8 CFU/ml
    Vector Information: Vector includes both 5' and 3' lentiviral LTR and all necessary elements for effective transduction; woodchuck hepatitis virus posttranscriptional regulatory element (WPRE)
    Promoter for Target Gene: U6
    Target Gene / Reporter(s): CHI3L1
    Species: Human
    Construct ID: shRNA TRCN0000051953
    Other Identifier: NM_001276.1-588s1c1
    Sequence: CCGGCAAGGAAATGAAGGCCGAATTCTCGAGAATTCGGCCTTCATTTCCTTGTTTTTG
    Knockdown Efficiency: N/A
    Selection Gene: Puromycin
    Biosafety Level: BSL-2
    
    Storage
    
    Store at -80°C
    
    Shipping
    
    Dry ice
    
    * For research use only. Not for diagnostic or therapeutic use.

Documents

User Instructions

Note: If you don't receive our verification email, do the following:

Confirm that you entered your email address correctly.
Check if the email is in your spam or junk folder.
Or you may contact us at .