FGF2 shRNA lentivirus

FGF2 shRNA lentivirus

Catalog Number:
PLP1516185CEL
Mfr. No.:
PLV-10110-50/200
Price:
$704
  • Size:
    Quantity:
    Add to Cart:
      • Overview
        • Fibroblast growth factor-2 (FGF2) is a member of the fibroblast growth factor (FGF) family. FGF2 has been implicated in diverse biological processes, such as limb and nervous system development, wound healing, and tumor growth. FGF2 is a potent angiogenic growth factor.

          This lentivirus expresses human FGF2 shRNA under the control of the U6 promoter..

          Please contact us at for specific academic pricing.

      • Properties
        • Other Properties
          Virus: FGF2 shRNA lentivirus
          Titer (approx): 1 x 10^8 CFU/ml
          Vector Information: Vector includes both 5' and 3' lentiviral LTR and all necessary elements for effective transduction; woodchuck hepatitis virus posttranscriptional regulatory element (WPRE)
          Promoter for Target Gene: U6
          Target Gene / Reporter(s): FGF2
          Species: Human
          Construct ID: shRNA TRCN0000003329
          Other Identifier: NM_002006.x-798s1c1
          Sequence: CCGGACTACAATACTTACCGGTCAACTCGAGTTGACCGGTAAGTATTGTAGTTTTTT
          Knockdown Efficiency: N/A
          Selection Gene: Puromycin
          Biosafety Level: BSL-2
          Storage
          Store at -80°C
          Shipping
          Dry ice

          * For research use only. Not for diagnostic or therapeutic use.

    Note: If you don't receive our verification email, do the following:

    Copyright © Amerigo Scientific. All rights reserved.