HPSE shRNA lentivirus, Ⅰ

HPSE shRNA lentivirus, Ⅰ

Catalog Number:
PLP1516187CEL
Mfr. No.:
PLV-10112-50/200
Price:
$704
  • Size:
    Quantity:
    Add to Cart:
      • Overview
        • Heparan sulfate proteoglycans are major components of the basement membrane and extracellular matrix. Heparanase (HPSE) is an enzyme that cleaves heparan sulfate proteoglycans to permit cell movement through remodeling of the extracellular matrix. HPSE is critical regulator of angiogenesis and tumor metastasis.

          This lentivirus expresses human HPSE shRNA under the control of the U6 promoter..

          Please contact us at for specific academic pricing.

      • Properties
        • Other Properties
          Virus: HPSE shRNA lentivirus
          Titer (approx): 1 x 10^8 CFU/ml
          Vector Information: Vector includes both 5' and 3' lentiviral LTR and all necessary elements for effective transduction; woodchuck hepatitis virus posttranscriptional regulatory element (WPRE)
          Promoter for Target Gene: U6
          Target Gene / Reporter(s): HPSE
          Species: Human
          Construct ID: shRNA TRCN0000139524
          Other Identifier: NM_006665.2-1746s1c1
          Sequence: CCGGCCAAAGTTGCTGCTTGCATCTCTCGAGAGATGCAAGCAGCAACTTTGGTTTTTTG
          Knockdown Efficiency: N/A
          Selection Gene: Puromycin
          Biosafety Level: BSL-2
          Storage
          Store at -80°C
          Shipping
          Dry ice

          * For research use only. Not for diagnostic or therapeutic use.

    Note: If you don't receive our verification email, do the following:

    Copyright © Amerigo Scientific. All rights reserved.