Angiopoietin-1 (Angpt1) shRNA lentivirus

Angiopoietin-1 (Angpt1) shRNA lentivirus

Catalog Number:
PLP1516178CEL
Mfr. No.:
PLV-10103-50/200
Price:
$704
  • Size:
    Quantity:
    Add to Cart:
      • Overview
        • Angpt1 gene encodes a secreted glycoprotein called Angiopoietin 1 that activates the receptor by inducing its tyrosine phosphorylation. It appears to play a crucial role in mediating reciprocal interactions between the endothelium and surrounding matrix and mesenchyme. It may also mediate blood vessel maturation/stability, and may be involved in early development of the heart. Angiopoietin 1 is a member of angiopoietin proteins family that plays important roles in vascular development and regulation of angiogenesis. All angiopoietins bind with similar affinity to an endothelial cell-specific tyrosine-protein kinase receptor.

          Please contact us at for specific academic pricing.

      • Properties
        • Other Properties
          Virus: Angiopoietin-1 (Angpt1) shRNA lentivirus
          Titer (approx): 1 x 10^8 CFU/ml
          Vector Information: Vector includes both 5' and 3' lentiviral LTR and all necessary elements for effective transduction; woodchuck hepatitis virus posttranscriptional regulatory element (WPRE)
          Promoter for Target Gene: U6
          Target Gene / Reporter(s): Angiopoietin-1 (Angpt1)
          Species: Human
          Construct ID: shRNA TRCN0000058638
          Other Identifier: NM_001146.3-917s1c1
          Sequence: CCGGCCCAGGTACTAAATCAAACTTCTCGAGAAGTTTGATTTAGTACCTGGGTTTTTG
          Knockdown Efficiency: N/A
          Selection Gene: Puromycin
          Biosafety Level: BSL-2
          Storage
          Store at -80°C
          Shipping
          Dry ice

          * For research use only. Not for diagnostic or therapeutic use.

    Note: If you don't receive our verification email, do the following:

    Copyright © Amerigo Scientific. All rights reserved.