Zebrafish p53 oligo

Zebrafish p53 oligo

Catalog Number:
NNNA502141GEN
Mfr. No.:
PCO-ZebrafishP53-100
Price:
$284
  • Size:
    100 nmol, 1mg
    Quantity:
    Add to Cart:
      • Overview
        • This is a Morpholino oligo targeting zebrafish p53, reported to suppress apoptotic effects induced by some Morpholinos (Robu et al. 2007, PLoS Genetics).

          Please contact us at for specific academic pricing.

      • Properties
        • Categories
          Danio rerio apoptosis suppression oligo
          Molecular Weight
          7804
          Other Properties
          Oligo sequence: GCGCCATTGCTTTGCAAGAATTG
          Molar Absorptivity: 236990
          Harmonizing Code: 2934999000
          Shipping Commodity Description: Synthetic non toxic reagent
          Restricted Item: Public

          * For research use only. Not intended or approved for diagnostic or therapeutic use.

    Note: If you don't receive our verification email, do the following:

    Copyright © Amerigo Scientific. All rights reserved.